Photo:

Anouk Gouvras

That is amazing! Thank you so much. I had such a great time and learnt a lot from the other scientist. Chris, you were a tough adversary!

Favourite Thing: So many things I love about science. I will have to think about this.

My CV

Education:

I attended the European School of Luxembourg until I was 18. I then moved to the UK to do a Zoology degree at the University of Wales, Bangor. Afterwards I did a Masters in the Control of parasite and their disease vectors at the Liverpool School of Tropical Medicine and finally a PhD at Imperial College

Qualifications:

BSc, MSc, PhD

Work History:

This is my first job

Current Job:

I am a Post-doctoral researcher working on Schistosomiasis

Employer:

Natural History Museum

Me and my work

I collect the DNA of small parasitic worms that infect people and animals in Africa

I research a disease called Schistosomiasis. This is caused by a parasitic worm called a schistosome. I collect samples of the parasite from infected humans and animals in different countries of sub-Saharan Africa. From this I can use the genetic information (within the parasite DNA) to help improve our understanding of parasite populations, how they infect people and animals, what effect treatment of the human population is having on the parasite population, and how this scientific research can/could help health programs in Africa.

I use genetic-fingerprinting which uses parts of DNA to distinguish between members of the same species. Two parasite worms of the same species have ALMOST the exact same DNA. Genetic fingerprinting uses parts of the DNA that are highly variable (differ between individuals of the same species) as ‘DNA markers’ so that we can tell ‘worm A’ from ‘worm B’ and from ‘worm C’ etc. The more closely related two individuals are, for example parents and children, the more similar the ‘DNA markers’ will be. And vice versa, the more unrelated two individuals are, the more different the ‘DNA markers’ will be.

The ‘DNA markers’ I use are called microsatellites. A microsatellite is a short non-coding (does not code for proteins) DNA sequence that is repeated X amount of times in a locus. The number of times this microsatellite sequence is repeated varies from individual to individual. For example,  if we have a microsatellite sequence of GTA, the number of times this sequence is repeated in Worm A might be 5: GTAGTAGTAGTAGTA and in Worm B it might be 8: GTAGTAGTAGTAGTAGTAGTAGTA

So for this GTA marker I have two different alleles, Allele A (which has 5 GTA repeats) and Allele B (which has 8 GTA repeats). Now lets say I have two groups of worms, group 1 and group 2. I will use my molecular marker to see how different or similar the worms in each group are from each other. So what is the diversity of these groups? I take the DNA, apply my marker for the GTA gene and then calculate how many worms in group 1 have Allele A and how many have Allele B. I do the same for group 2.

Lets say: in group 1 I find that half of the worms have Allele A and the other half have Allele B.

in group 2 I find that 80% of the worms have Allele A and only 20% have Allele B.

This means that group 1 is more diverse than group 2.

This is called population genetics. It is the study of the distribution of and change in allele frequencies and what has caused these differences/changes.

I use lots of these microsatellite loci as my ‘DNA markers’ to look at how the diversity of parasite worms might be changing as people are being treated with drugs to kill the parasite. This can give us a lot of information about the success or failure of our treatment programs.

For example, if group 1 (the diverse group) is the diversity before the treatment program has started, and group 2 (the less diverse group) is one year after the treatment has started, then clearly the treatment is reducing the diversity of the worms. But why are the worms with Allele A not as affected by treatment as the worms with Allele B? Are we introducing a selection on the worm population? Are we perhaps selecting for treatment resistance (we only have one treatment for these parasite worms, if it fails we have no alternatives)? And what if we do not treat every year but every second year instead? Will the allele frequencies not change?

These are the questions I am trying to answer with my research. And I hope that these answers will help treatment programs in deciding what the best treatment method (annual v.s. every second year, everybody v.s. just children) is in an area with these parasitic worms.

My Typical Day

In the UK I go to my office and open the computer or I go to the lab to start working on collected parasite DNA, in Tanzania I go to a school or a lake to collect parasite DNA

What I'd do with the money

The money would be used in our project to eliminate schistosomiasis (the parasite I research) in Zanzibar by teaching school children in Zanzibar about the parasite and how to avoid getting infected.

My Interview

How would you describe yourself in 3 words?

kind, independent, happy

Who is your favourite singer or band?

I don’t have one, I like lots of different music.

What is the most fun thing you've done?

oooooh ummm I went diving in the UK and saw sea cucumbers spawning on a ship wreck oh also went diving with manta rays in Hawaii also went surfing in Cornwall, I play horse polo which is loads of fun, and recently I cycled from London to Paris with some friends which was amazing (and painful). I can’t always decide what is the most fun, sometimes just going out with my family is really fun.

If you had 3 wishes for yourself what would they be? - be honest!

a better memory so I wouldn’t forget things I read and have to keep looking them up, a garden because I love plants and gardening, and of-course money because then I could also get a dog, a horse, a goat, presents for my family, fund charities, sponsor people to do amazing things and maybe buy a small island :)

What did you want to be after you left school?

well at the age of 7/8 I wanted to be a vet and then I didn’t think about it till I was 15 and decided science was more interesting and less scary. At 16 I narrowed it down to biology, at 18 I went for zoologist.

Were you ever in trouble in at school?

sometimes yes. best to ask my mum

What's the best thing you've done as a scientist?

talking to people about science and how great it is. Enthusiasm is contagious.

Tell us a joke.

oh no! I’m bad at jokes, I always tell them the wrong way and people don’t get it. I like hearing jokes though. You tell me a joke.

Other stuff

Work photos:

I have added some photos from my fieldwork in Africa. I collect the parasite from infected snails (which is one of the hosts of schistosome worms) below I am collecting snails from a water canal near a village in Niger, West Africa. The villagers were very curious about what I was doing in their canal. myimage1

And I collect parasites from school children (humans and other animals are the other host of schistosomes). Below I am using a microscope to collect and store parasites that have come from the urine of infected children in Niger, West Africa. I am sitting in one of the village huts. myimage2

This is a photo of a typical Tanzanian primary schoolmyimage3

And here I am with a large collection of urine pots from the school kids. And the wonderful team I work withmyimage4.

I have added slide on the life cycle of schistosomes, I hope you find it useful myimage5