Profile
Anouk Gouvras
That is amazing! Thank you so much. I had such a great time and learnt a lot from the other scientist. Chris, you were a tough adversary!
My CV
-
Education:
I attended the European School of Luxembourg until I was 18. I then moved to the UK to do a Zoology degree at the University of Wales, Bangor. Afterwards I did a Masters in the Control of parasite and their disease vectors at the Liverpool School of Tropical Medicine and finally a PhD at Imperial College
-
Qualifications:
BSc, MSc, PhD
-
Work History:
This is my first job
-
Current Job:
I am a Post-doctoral researcher working on Schistosomiasis
-
Read more
I research a disease called Schistosomiasis. This is caused by a parasitic worm called a schistosome. I collect samples of the parasite from infected humans and animals in different countries of sub-Saharan Africa. From this I can use the genetic information (within the parasite DNA) to help improve our understanding of parasite populations, how they infect people and animals, what effect treatment of the human population is having on the parasite population, and how this scientific research can/could help health programs in Africa.
I use genetic-fingerprinting which uses parts of DNA to distinguish between members of the same species. Two parasite worms of the same species have ALMOST the exact same DNA. Genetic fingerprinting uses parts of the DNA that are highly variable (differ between individuals of the same species) as ‘DNA markers’ so that we can tell ‘worm A’ from ‘worm B’ and from ‘worm C’ etc. The more closely related two individuals are, for example parents and children, the more similar the ‘DNA markers’ will be. And vice versa, the more unrelated two individuals are, the more different the ‘DNA markers’ will be.
The ‘DNA markers’ I use are called microsatellites. A microsatellite is a short non-coding (does not code for proteins) DNA sequence that is repeated X amount of times in a locus. The number of times this microsatellite sequence is repeated varies from individual to individual. For example, if we have a microsatellite sequence of GTA, the number of times this sequence is repeated in Worm A might be 5: GTAGTAGTAGTAGTA and in Worm B it might be 8: GTAGTAGTAGTAGTAGTAGTAGTA
So for this GTA marker I have two different alleles, Allele A (which has 5 GTA repeats) and Allele B (which has 8 GTA repeats). Now lets say I have two groups of worms, group 1 and group 2. I will use my molecular marker to see how different or similar the worms in each group are from each other. So what is the diversity of these groups? I take the DNA, apply my marker for the GTA gene and then calculate how many worms in group 1 have Allele A and how many have Allele B. I do the same for group 2.
Lets say: in group 1 I find that half of the worms have Allele A and the other half have Allele B.
in group 2 I find that 80% of the worms have Allele A and only 20% have Allele B.
This means that group 1 is more diverse than group 2.
This is called population genetics. It is the study of the distribution of and change in allele frequencies and what has caused these differences/changes.
I use lots of these microsatellite loci as my ‘DNA markers’ to look at how the diversity of parasite worms might be changing as people are being treated with drugs to kill the parasite. This can give us a lot of information about the success or failure of our treatment programs.
For example, if group 1 (the diverse group) is the diversity before the treatment program has started, and group 2 (the less diverse group) is one year after the treatment has started, then clearly the treatment is reducing the diversity of the worms. But why are the worms with Allele A not as affected by treatment as the worms with Allele B? Are we introducing a selection on the worm population? Are we perhaps selecting for treatment resistance (we only have one treatment for these parasite worms, if it fails we have no alternatives)? And what if we do not treat every year but every second year instead? Will the allele frequencies not change?
These are the questions I am trying to answer with my research. And I hope that these answers will help treatment programs in deciding what the best treatment method (annual v.s. every second year, everybody v.s. just children) is in an area with these parasitic worms.
-
My Typical Day:
In the UK I go to my office and open the computer or I go to the lab to start working on collected parasite DNA, in Tanzania I go to a school or a lake to collect parasite DNA
-
What I'd do with the prize money:
The money would be used in our project to eliminate schistosomiasis (the parasite I research) in Zanzibar by teaching school children in Zanzibar about the parasite and how to avoid getting infected.
-
My Interview
-
How would you describe yourself in 3 words?
kind, independent, happy
Were you ever in trouble at school?
sometimes yes. best to ask my mum
Who is your favourite singer or band?
I don’t have one, I like lots of different music.
If you had 3 wishes for yourself what would they be? - be honest!
a better memory so I wouldn’t forget things I read and have to keep looking them up, a garden because I love plants and gardening, and of-course money because then I could also get a dog, a horse, a goat, presents for my family, fund charities, sponsor people to do amazing things and maybe buy a small island :)
Tell us a joke.
oh no! I’m bad at jokes, I always tell them the wrong way and people don’t get it. I like hearing jokes though. You tell me a joke.
-